Names _________________

• Login using "C581" as the user and use the password supplied in class.
• Open a UNIX shell and start Insight2.

It will help to have the text in front of you while working through this problem set.

Minor Groove Binders

1. Go to "File" and select "Restore_Folder." Click on slato/ and choose the file "Netropsin.psv." This file shows double stranded DNA with a small molecule bound specifically to it. The DNA is colored by atom in the region of interest, dark blue on the ends, and the small molecule in yellow. The diagram is shown below (JACS (1992) Vol. 114, No. 23, pg 8784). An interesting feature of this structure is that the hydrogen bonds are bifurcated (a single hydrogen can form two hydrogen bonds at the same time). On the diagram, draw the appropriate hydrogen bonds, indicate the atom number (which is given to you below the command line when you click on an atom), and the hydrogen bond distances. An easy way to find the hydrogen bonds in the structure is to pick all the central atoms by making a box with the left mouse button and then click on "Measure" and choose "Hbond." Click on "Execute."

This will not give you all the possible hydrogen bonds, but it is a start.

Delete this molecule.

2. Go to "File" and select "Restore_Folder." Choose the file "heterodimer1.psv." This file shows double stranded DNA with two small molecules (distamycin and 2-imidazole netropsin) bound specifically to it. The DNA is colored by atom in the region of interest, dark blue on the ends, and the small molecules in yellow. Which groove do the two small molecules bind to? Why do they bind specifically?
3. Below is a schematic of the small molecules binding specifically to DNA (JACS (1993) Vol. 115, No. 7, pg 2573). On the diagram, draw the appropriate hydrogen bonds, indicate the atom number (which is given to you below the command line when you click on an atom), and the hydrogen bond distances.

Delete this molecule.

Affinity Cleaving

1. Next, we will look at Fe-EDTA cleavage. Go to "File" and select " Restore_Folder."

Choose the folder "pattern.psv." This file is already oriented as shown below, that is the 5’ A is in the top left corner of your screen. The dots indicate the sugars that are cleaved when an oligo containing T* binds to the duplex to from a triplex.

5’ - ATATATAAAAAGAGAGAGAGA - 3’

3’ - TATATATTTTTCTCTCTCTCT - 5’

Using the cleavage pattern given above, change the color of the sugars that are cleaved. First, rotate the molecule until you can see a sugar molecule that is cleaved. Then, use the left mouse button to draw a box around it. Click on "Molecule" and select "Color." Make sure "Subset" is selected in the Molecule Pick Level box. Choose a color in the Color box and click on "Execute." Click on "Cancel" to remove the box. Repeat this until all the sugars are colored. After you have changed the sugar colors, you should see a pattern to them. What groove does the oligo-T* lie in to give this pattern?

2. 2-pyridine-netropsin binds specifically to a different site on this molecule and gives the cleavage pattern shown below. You can either delete the molecule and then restore the folder again or color the whole molecule a single color to get rid of the above cleavage pattern. Color the molecule again using the cleavage pattern below. What groove does 2-pyridine-netropsin bind to?

5’ - ATATATAAAAAGAGAGAGAGA - 3’

3’ - TATATATTTTTCTCTCTCTCT - 5’

 

Group I Intron

Click on "Molecule" and select "Get." Make sure "PDB" is selected in the Get File Type box. Click on "../" in the Files box. Finally, select the file 1gid.pdb and click on "Execute. " You will probably have to click on the "Sideview" box and move the bars to bring the molecule into view on the screen.

1. At first sight, this molecule appears to be a massive mess. However, it is really two asymmetric molecules. One is strand A and the other is strand B. In order to make viewing the Group I Intron easier, we will delete one molecule. Go to "Molecule " and select "Display." Select "Only" in the Display Operation box. In the Molecule Spec box, type :A* after GID so that only the A strand will be shown. Click on "Execute."
2. In the last problem set, we learned how to jot a pdb file in order to learn the contents of the file (i.e. A = intercalator, C = DNA, etc.). There is another way to determine the contents of each strand and the numbering of the residues. Click on the blue and white star-like icon in the upper left corner. Select the "Biopolymer " option. After the second row of commands appears, click on "Residue" and select "List." A command box will appear on the screen. Remove the colon after A* and click on "Execute." A UNIX shell will appear that gives you the strand coding letter (A will be the only one for this molecule), the residue number, and the residue type (i.e. A, U, G, or C). The spacebar will allow you to page down in the UNIX shell. What residue corresponds to numbers 200, 205, 208, and 210? Click on "Textport Off" to remove the UNIX shell when you are done.
3. Draw a ribbon through the backbone of the molecule. Select "Molecule" and choose "Ribbon." Make sure "Create" is selected in the Ribbon Operation box, "GID:A*" is selected in the Molecule Spec box, and " Nucleic" is selected in the Molecule Type box. Click on "Execute."
4. Color the tetraloop, tetraloop receptor, and the A-rich bulge according to the color scheme used in the Cate et al. paper. To color a single residue or a string of residues, go to "Molecule" and choose "Color." After the name of the molecule, type :A and then the number of the residue(s) (i.e. GID:A152 or GID:A150-157 or GID:A132, A146, A132-137). Next, select the appropriate color and click on "Execute." Now, only those residues will be colored. Have your colored structure checked by Diana or Martha.
5. The "ribose zipper" is an important structural motif formed by a pair of riboses interacting via hydrogen bonding. The "ribose zipper" motif can be found in the A-rich bulge and the tetraloop long-range contacts. Locate a "ribose zipper" in the A-rich bulge. Describe the hydrogen bonding pattern (be sure to indicate the atoms involved).
6. Base triplets are another important interaction in the Group I Intron. These can be observed in the tetraloop – tetraloop receptor interaction. Find one of these base triplets and list the nucleotides involved.
7. Explain the concept of coaxial stacking. The structure shows the P4, P5a, P5b, P5c, and P6 domains. Which are coaxial stacked?